Document Type : Original researches
Abstract
Keywords
Main Subjects
Genetic Characterization of Multi Drug Resistant Staphylococcus Spp. in Raw Milk and Karish cheese
Amany M. Ahmed1 and Ghada Abdelaal2
1Food hygiene Department, Animal Health Research Institute (AHRI), Ismailia Branch, Agriculture Research Center (ARC), 41511, Egypt
2 Bacteriology Department, Animal Health Research Institute (AHRI), Ismailia Branch, Agriculture Research Center (ARC), 41511, Egypt. https://orcid.org/0000-0002-8067-6072
Correspondence: e-mail: Dr.ghadaabdelaal@ahri.gov.eg.
Abstract
Multi drug resistant (MDR) Staphylococcus spp. particularly the emerging Methicillin-resistant S. aureus (MRSA) strains are of serious zoonotic public health concern. The scope of this study was to analyze the incidence of Staphylococcus spp. with a focus on S. aureus and MRSA strains and evaluate their staphylococcal enterotoxins (SE) and resistance genes. A total of 330 samples of raw milk from animals (cows, buffaloes, sheep and goat) and Karish cheese (as a major risk for in dairy industry) were screened and examined. The prevalence ratio of S. aureus in raw milk (from examined farm animals or milk smallholders) and in cheese was 38.5% (127/330) however, non-S. aureus (NSA) was identified in 16.7% (55/330). Multi Drug Resistant (MDR) pattern of S. aureus isolates was exhibited with identification of MRSA strains in (44.9%). Penicillin showed the highest resistance level (55.1%) however, gentamycin was the most sensitive one. S. aureus strains were confirmed with the presence of nuc gene in 100% with PCR tool however, PCR for SE genes declared that seb was prevalent in 85.7% followed by sed and sea genes in (64.3% and 28.5%), respectively. Furthermore, β-lactam resistance (blaZ and mecA) genes were found in 100% and 50%, respectively. This data suggested that monitoring and surveillance plans with strict control measures in dairy farms should be applied to lessen the spread of MDR Staph spp. especially MRSA strains. Also, awareness of milk smallholders and farm workers must be raised to ensure the quality of raw milk for safe public health concern.
Keywords: Raw milk, karish cheese ,MDR Staph. aureus, MRSA , Food poisning, PCR, antibiotic resistance .
Introduction
Staphylococcus species is ubiquitous organisms persist normally in the air, soil, water, milk and milking equipment in dairy animal farms (Saka and Terzi Gulel 2018). S. aureus is one of major pathogenic food-borne bacteria according to the records of WHO organization (Mahfoozi et al. 2019).
Raw milk is an extremely common and genuine risk to the dairy industry in which S. aureus could be a potential pathogen that are responsible for intramammary infections in dairy animals leading to mastitis and huge economic losses (De Silva et al. 2016). Although the milk possesses a high nutritive value and rich protein, vitamins, and minerals; it also had been regarded as favorable medium for viability and growth of various types of food borne organisms intensifying the public health risks in both human and animals (Pandey et al. 2014). Staph aureus organisms were detected previously in raw milk, cheese, ice cream, clotted cream, and butter (Saka and Terzi Gulel 2018).
The virulence and pathogencity of S. aureus could emerge from its capability to produce a set of potent intracellular proteins (toxins) that called Staphylococcal Enterotoxins or (SE). They could intern contaminate the milk either in raw form or in other artisanal form of dairy products (Gebremedhin et al. 2022; Lee et al. 2016). Staphylococcal Enterotoxins are heat-stable, single-chain proteins, of low molecular weight (27-31 kDa). These toxins could resist the action of denaturing agents and a wide range of pH (Özdemir and Keyvan 2016). Also, they couldn’t be degraded with the proteolytic enzymes (pepsin, trypsin, and chymotrypsin) so can be active even after ingestion inside the digestive tract passing through the stomach and attacking the intestinal cells (Mahfoozi et al. 2019). Hence, SE producing strains of S. aureus could grow in variable extreme conditions and easily contaminate the dairy products during stages of processing or preparation constituting great potential risks of food poisoning (Wang et al. 2017).
The scientists identified about twenty-three serologically distinct SE and Sel (Staphylococcal Enterotoxin like) proteins (Benkerroum 2018; Rong et al. 2017). Both SE and Sel toxins were found to be intended for major outbreaks of staphylococcal foodborne (Umeda et al. 2017). It is recorded that 95% of food poisoning outbreaks with Staph species; were linked with the main five classical biotypes (A, B, C, D, and E) of S. aureus while 5% only could be happened due to the new biotypes (Tang et al. 2011). Polymerase Chain Reaction (PCR) is an efficient, rapid, accurate and reliable screening assay for the detection of SE toxins in raw milk samples that might be contaminated with S. aureus organisms (Avila-Novoa et al. 2018).
MRSA are emerging serious group of S. aureus species that mainly associated with several cases of human hospital and community-acquired infections (Gopal and Divya 2017). MRSA are one of the life-threatening contagions which is truly notable in various types of contaminated milk and dairy products resulting in community health anxiety (Alghizzi and Shami 2021). Moreover, MRSA was reported in many studies in bovine milk and dairy animals especially with mastitis that permit MRSA group to be readily transferable to humans in contact (Basanisi et al. 2017; Caruso et al. 2016; Liu et al. 2022). On the contrary, little knowledge had been reported about the prevalence of MRSA in other animals (e.g., sheep, goats, camels), although the consumption of milk from different animal species is more and more common.
Unfortunately, in the veterinary field, antibiotics had been utilized for both therapeutic and sub-therapeutic purposes to promote growth and improve feed efficiency in animals (Van Soest et al. 2016). This practice led to phenomena which is known as antimicrobial resistance (AMR). AMR of S. aureus strains had been exponentially growing and developing in the last decade all over the world. It is associated mainly with an indiscriminate usage of antimicrobials by healthcare providers, untrained practitioners, or medication consumers (Pekana et al. 2017). So, no susceptibility of S. aureus strains against penicillin and tetracycline drugs for example was documented due to regular use in the treatment in dairy farms that could produce new antibiotic resistant strains and the growing AMR phenomenon (Gebremedhin et al. 2022). Nowadays, there is an increased public and scientific concern regarding extensive use of antimicrobials to limit the emergence and dissemination of multiple antibiotic resistant zoonotic bacterial pathogens (Bueno et al. 2018; El-Fateh et al. 2020).
The aim of this study was to estimate the prevalence of S. aureus spp. particularly MRSA strains in raw milk and Karish cheese and detect their staphylococcal count with a focus on their phenotypic and genotypic antibiotic resistance traits along with PCR analysis of staphylococcal enterotoxins (SE) in these isolates trying to evaluate the potential risks from contaminated milk and products in human and public health concerns.
Materials and Methods
1-Study design and sample Collection:
A total of 330 samples were used in this study. Two hundred and fourty raw milk samples (60 raw bulk tank milk samples were obtained from cows and 60 from buffaloes in different dairy farms which depend mainly on traditional methods of hand milking technique, 120 raw unpasteurized milk samples from milk smallholders), 30 ewe’s milk samples, 30 ewe’s goat milk and 30 homemade Karish cheeses were collected and examined. The samples were gathered from different districts at Ismailia Governorate, Egypt. This study was performed during the period from October 2021 to July 2023.
In a farm, the bulk tank milk had been collected after milking all dairy animals then mixed in a large container in a specific milk collection area. The samples were taken before anyone enter the farm for keeping a good hygiene in the dairy farms at the milk collection site. To make representative samples of bulk milk either at farms or from smallholder sources; samples should be thoroughly homogenized and mixed before taking the representative sample. Also, all samples were collected aseptically in sterile plastic tubes and stored at 4°C to be further examined.
However, Karish cheese samples were homemade synthesized. About one hundred grams of Karish cheese of each sample was collected in sterile separate containers and maintained at 4°C to be further examined. All samples were taken under sterile conditions and transported without any delay to AHRI (Animal Health Research Institute) bacteriological laboratory to be bacteriological and PCR examined.
2- Enumeration of Staphylococci and S. aureus in raw samples of milk and Karish cheese:
Total Staphylococci and S. aureus count was performed according to (IS0, 2003: 6888–1:1999 +A1) guidelines.
3- Bacterial isolation of Staphylococci spp. in raw milk and Karish cheese:
The isolation and identification of Staphylococci spp. and S. aureus was done according to (IS0, 2003: 6888–1:1999 +A1). The produced typical colonies of Staphylococci spp on Mannitol salt and Baird parker agar media plates were picked up to be purified on trypticase soya agar and re-incubated for 24 h at 37°C (TSA, Oxoid Ltd., Hampshire, England). All identified Staphylococci colonies were stained with Gram stain and biochemically identified via (catalase, oxidase, coagulase test and mannitol fermentation tests) (Wakabayashi et al. 2018). Moreover, other coagulase negative Staphylococci (CNS) isolates were tested using the Integral system stafilococchi kit (Liofilchem). The purified Staph colonies were preserved at −80 °C in 30% glycerol for further studies.
4- Antibiogram pattern of the recovered S. aureus isolates:
All biochemically confirmed S. aureus isolates in this study were tested for antimicrobial sensitivity and resistance patterns with the Kirby–Bauer disk diffusion method and the inhibition zones were measured and interpreted as sensitive (S), intermediate (I), and resistant (R) according to the guidelines of the Clinical and Laboratory Standards Institute; CLSI, 2020 (Weinstein and Lewis 2020). The following antimicrobial agents of different antibiotic classes were used: Penicillin, Norfloxacin, Oxacillin, Oxytetracycline, Chloramphenicol, Amoxicillin, Trimethoprim-sulfamethoxazole, Azithromycin, Linezolid, Doxycycline, Ciprofloxacin, Fosfomycin, Cefotaxime and Gentamycin. S. aureus isolates that were found to be resistant to ≥ 3 antibiotic classes were considered multidrug-resistant (MDR) strains.
5- Genotypic investigation of virulent and SE associated genes of S. aureus DNA isolation:
For this purpose, overnight incubated cultures of the recovered S. aureus on Brain Heart Infusion broth (BHI, Oxoid) were prepared using 2 ml of freshly BHI broth with 0.1 ml of S. aureus tested cultures. The PCR sample suspensions were incubated then with 20 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After that, 2 ml of 100% ethanol was added to the lysate. The samples were then centrifuged at 5.000 rpm for 10 minutes and the supernatants were discarded. Washing of bacterial pellets twice was performed with 1 ml of saline solution, centrifuged again and resuspended in 180 μl Tris EDTA buffer (Sigma) containing 18 μl of lysostaphin (0.5 U/μl, Sigma, L7386) then incubated at 37°C for 1 hour (Akineden et al. 2008). This protocol of DNA extraction was done according to QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with some modifications of AHRI, from the manufacturer’s recommendations.
In the current study, S. aureus reference strain (that was kindly provided by AHRI, Dokki, Giza and confirmed as S. aureus) used as positive control. Firstly, the selected strains of S. aureus were confirmed with detection of nuc identification genes using specific primers. Also, specific primer sets were used to detect (SE) staphylococcal enterotoxin (sea, seb, sec, sed, see) genes (Johnson et al. 1991; Monday and Bohach 1999). The amplification cycling conditions of each gene, primers sequences, target genes, oligonucleotide primers (that were supplied from Metabion; Germany) and amplicon sizes were tabulated in (Table A). The PCR reaction was performed in an Applied biosystem 2720 thermal cycler. Then, separation of PCR products was done by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. After that, for gel analysis, PCR reaction products were loaded in each gel slot and the fragment sizes were determined with the use of a gene ruler 100 bp ladder (Fermentas, thermofisher, Germany). Finally, the gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software (Keyvan and Özdemir 2016).
Table (A): Primers sequences, target genes, amplicon sizes and cycling conditions of S. aureus isolates
Target gene |
Primers sequences |
Amplified segment (bp) |
Primary Denaturation ˚C/min |
Amplification (30-35 cycles) |
Final extension ˚C/min |
Reference |
||
Secondary denaturation ˚C/Sec |
Annealing ˚C/Sec |
Extension ˚C/Sec |
||||||
Nuc |
F: ATA GGG ATG GCT ATC AGT AAT GT R: GAC CTG AAT CAG CGT TGT CTT C |
624 |
94/5 |
94/30 |
55/30 |
72/40 |
72/10 |
(Lem et al. 2001) |
Sea |
F: GGT TAT CAA TGT GCG GGT GG R: CGG CAC TTT TTT CTC TTC GG |
102 |
94/5 |
94/30 |
55/30 |
72/40 |
72/10 |
(Mehrotra et al. 2000)
|
Seb |
F: GTATGGTGGTGTAACTGAGC |
164 |
94/5 |
94/30. |
57/30 |
72/30 |
72/7 |
|
R: CCAAATAGTGACGAGTTAGG |
||||||||
Sec |
F: AGA TGA AGT AGT TGA TGT GTA TGG |
541 |
94/5 |
94/30 |
57/30 |
72/30 |
72/7 |
|
R: CAC ACT TTT AGA ATC AAC CG |
||||||||
Sed |
F: CCAATAATAGGAGAAAATAAAAG |
278 |
94/5 |
94/30 |
57/30 |
72/30 |
72/7 |
|
R: ATTGGTATTTTTTTTCGTTC |
||||||||
See |
F: AGG TTT TTT CAC AGG TCA TCC |
209 |
94/5 |
94/30 |
57/30 |
72/30 |
72/7 |
|
R: CTT TTT TTT CTT CGG TCA ATC |
||||||||
mecA |
F: TCCAGATTACAACTTCACCAGG |
162 |
95/5 |
95/60 |
54/60 |
72/60 |
72/7 |
(Oliveira et al. 2016) |
R: CCACTTCATATCTTGTAACG |
||||||||
blaZ |
F: TACAACTGTAATATCGGAGGG |
861 |
95/5 |
95/60 |
54/60 |
72/60 |
72/7 |
|
R: R: CATTACACTCTTGGCGGTTTC |
Results:
Total counts for Staphylococci and S. aureus spp. in raw milk and cheese samples:
As mentioned in table (1), the examination of raw milk samples from buffalo and cow in dairy farms and from milk smallholders (n=60) for total staphylococci count confirmed the presence of Staphylococcus spp. in different ratios. The mean value for Staphylococcus spp. count was calculated as 9.5x102 ± 2.5x102, 3x104 ± 0.2x104 for cows, 5.6x102 ± 1.7x102, 4.9x105 ± 5.7x104 for buffaloes from dairy farm and milk smallholders, respectively. Meanwhile the mean value for ewes, ewe's goat raw milk was 2.5x102±1 x102 and 1.2x102 ± 0.2x102, respectively while for Karish cheese, it was 7.5x102 ± 0.4x102.
Table (1) Statistical analytical results of Staphylococcal counts in different types of raw milk and Karish cheese
Samples |
No. of samples |
Positive samples |
Min. |
Max. |
Mean |
±S.E |
||
No. |
% |
|||||||
Raw bulk tank milk from animal farms |
Cow |
60 |
18 |
30 |
7x10 |
5.3x104 |
9.5x102 |
2.5x102 |
Bufflo |
60 |
12 |
20 |
4x10 |
6x103 |
5.6x102 |
1.7x102 |
|
Raw milk from smallholders |
Cow |
60 |
37 |
61.7 |
2x103 |
4x105 |
3x104 |
0.2x104 |
bufflo |
60 |
29 |
48.3 |
5x10 |
8.5x106 |
4.9x105 |
5.7x104 |
|
Raw ewes’ milk |
30 |
12 |
40 |
3x10 |
1.6x104 |
2.5x102 |
1 x102 |
|
Raw ewe's goat milk |
30 |
10 |
33.3 |
4x10 |
2x103 |
1.2x102 |
0.2x102 |
|
Homemade Karish cheese |
30 |
9 |
30 |
5x102 |
4x103 |
7.5x102 |
0.4x102 |
N.B. Statistical (Min, Max and mean ±SE) was carried for positive samples only.
The obtained results in Table (2) revealed that the raw milk from smallholders have the highest staph counts than raw bulk tank milk from animal farms. Meanwhile, the highest distribution 60%, 42% and 89% of the ewe’s, goat milk and Karish cheese were approximately similar in frequency distribution of staphylococcal counts.
Table (2): Frequency distribution of staphylococcal counts in different types of raw milk and Karish cheese.
Frequency level |
Raw bulk tank milk from animal farms |
Raw milk from smallholders |
Ewes sheep |
Ewes Goat |
Karish cheese |
|||||||||
Cow |
buffalo |
Cow |
buffalo |
|||||||||||
No. |
% |
No. |
% |
No. |
% |
No. |
% |
No. |
% |
No. |
% |
No. |
% |
|
>10-102 |
5 |
27.8 |
2 |
16.5 |
- |
- |
1 |
3.5 |
3 |
25 |
3 |
30 |
- |
- |
102-103 |
10 |
55.6 |
8 |
67 |
- |
- |
2 |
6.5 |
5 |
42 |
6 |
60 |
8 |
89 |
103-104 |
3 |
16.6 |
2 |
16.5 |
10 |
27 |
2 |
6.5 |
2 |
16.5 |
1 |
10 |
1 |
11 |
104-105 |
- |
- |
- |
- |
23 |
62 |
19 |
65.5 |
2 |
16.5 |
- |
- |
- |
- |
105-106 |
- |
- |
- |
- |
4 |
11 |
2 |
7 |
- |
- |
- |
- |
- |
- |
106-107 |
- |
- |
- |
- |
- |
- |
3 |
10.5 |
- |
- |
- |
- |
- |
- |
Total |
18 |
100 |
12 |
100 |
37 |
100 |
29 |
100 |
12 |
100 |
10 |
100 |
9 |
100 |
Incidence and distribution of S. aureus and other Staph spp. in raw milk and cheese samples:
A total of 38.5% (127/330) were positive for coagulase positive S. aureus as illustrated in table (3). Statistically, non-significant differences were observed between the different sources for S. aureus prevalence (p>0.05). The total incidence rate of S. aureus spp. was 40 % (96/240) in cow and buffalo’s raw milk, either its source was dairy farms or milk smallholders. In addition, S. aureus (CPS) was also isolated in 40% and 33.4 % in raw milk samples from ewes of sheep and goat origin, respectively. Also, 30% (9/30) of all examined homemade Karish cheese in this study were contaminated with S. aureus spp. Moreover, the totally other identified Staph species were 55/330 (16.7%) as shown in figure (1) and considered unfit for human consumption as the parameters mentioned in Egyptian Standards “ES 1008-4/2005”.
Table (3): Prevalence rate of S. aureus and other Staph spp. isolates from raw milk and Karish cheese.
S. aureus spp. and origin of sample (n= number of samples) |
S. aureus (CPS) |
Other staph species (NAS) |
|
Raw bulk tank milk from animal farms |
Cows (n=60) |
18/60 (30%) |
10/60 |
Buffaloes (n=60) |
12/60 (20%) |
9/60 |
|
Raw bulk milk from milk smallholders |
Cows (n=60) |
37/60 (61.7%) |
8/60 |
Buffaloes (n=60) |
29/60 (48.4%) |
11/60 |
|
Total raw milk from both cow and buffalo’s animals (n=240) |
96/240 (40%) |
38/240 (15.8%) |
|
Raw ewes’ milk |
Sheep (n=30) |
12/30 (40%) |
5/11 |
Raw ewe’s goat milk |
Goat (n=30) |
10/30 (33.4%) |
6/12 |
Total raw milk samples from all animals (n=300) |
118/300 (39.3%) |
49/300 (16.3%) |
|
Homemade Karish cheese |
Cheese (n=30) |
9/30 (30%) |
6/15 (40%) |
Total |
N= 330 |
127/330 (38.5%) |
55/330 (16.7%) |
CPS= Coagulase Positive S. aureus NSA= Non-Staph aureus
Biochemical confirmation of the recovered S. aureus isolates:
All the suspected S. aureus isolates that were yielded in this study from different sample sources gave positive reactions for catalase, Voges Proskauer and coagulase tests. Also, they fermented glucose, lactose, sucrose, maltose and mannitol with acid production, but they were negative for oxidase test. Staph species other than S. aureus (NSA) were also biochemically identified as illustrated in Figure (1). In the same context, this figure showed significant differences (p<0.001) between the other microbial species in different milk sources, maximizing for S. epidermidis (10%).
Figure (1): Prevalence rate of S. aureus and other Staph spp. isolates from raw milk and Karish cheese samples.
Antibiogram sensitivity results of S. aureus isolates:
Most of the tested S. aureus isolates in this study were multidrug resistant strains (MDR) which means that they were resistant to three or more antimicrobial agents of different antibiotic classes. Individual resistance profiles were demonstrated in Table (4). The highest antibiotic resistance of S. aureus isolates was observed for penicillin (55.1%) in addition, other antibiotics of different classes included norfloxacin, oxacillin, oxytetracycline, chloramphenicol and amoxycillin showed a resistance range (40.2% - 51.2%) and to a lesser extent to linezolid (25.9%), doxycycline (23.6%) and ciprofloxacin (22%). Meanwhile, the highest sensitivity rates were observed in S. aureus isolates for gentamycin, cefotaxime and Fosfomycin. Significant associations were observed between antimicrobial resistance potency of different antibiotic and the animal sources of the recovered strain (p<0.001; Figure 2).
Moreover, according to the resistance pattern that was indicated by oxacillin resistance, MRSA (methicillin resistant S. aureus) species were also detected in 44.9% in all samples in this study. MRSA was isolated in 26/55 (47.3%), 18/41 (43.9%), 6/12 (50%) and 4/10 (40%) from cows, buffaloes, sheep and goat species as well as from 3/9 (33.3%) of examined cheese samples (Figure 2).
Figure (2): Antibiogram sensitivity and resistance profile patterns of the recovered S. aureus isolates
Table (4): Antibiogram sensitivity and resistance profile patterns of the recovered S. aureus isolates
Antibiotics (Type/Conc) |
Abb. |
Antibiotic group |
recovered isolates from |
Total (127) |
||||||||||
Cows (55) |
Buffaloes (41) |
Sheep (12) |
Goat (10) |
Karish cheese (9) |
||||||||||
R |
% |
R |
% |
R |
% |
R |
% |
R |
% |
R |
% |
|||
Penicillin (10 µg) |
P |
28/55 |
50.9% |
21/41 |
51.2% |
9/12 |
75% |
7/10 |
70% |
5/9 |
55.6% |
70/127 |
55.1% |
|
Norfloxacin (10 µg) |
N |
27/55 |
49.1% |
20/41 |
48.8% |
8/12 |
66.7% |
6/10 |
60% |
4/9 |
44.4% |
65/127 |
51.2% |
|
Oxacillin (5 µg) |
OX |
26/55 |
47.3% |
18/41 |
43.9% |
6/12 |
50% |
4/10 |
40% |
3/9 |
33.3% |
57/127 |
44.9% |
|
Oxytetracycline (30 µg) |
OT |
Tetracycline |
26/55 |
47.3% |
19/41 |
46.3% |
6/12 |
50% |
3/10 |
30% |
2/9 |
22.2% |
56/127 |
44.1% |
Chloramphenicol (30 µg) |
C |
Chloramphenicol |
25/55 |
45.5% |
17/41 |
41.5% |
5/12 |
41.7% |
3/10 |
30% |
2/9 |
22.2% |
52/127 |
40.9% |
Amoxicillin (25 µg) |
AMX |
24/55 |
45.2% |
17/41 |
41.5% |
5/12 |
41.7% |
5/10 |
50% |
-- |
-- |
51/127 |
40.2% |
|
Trimethoprim sulfamethoxazole (25 µg) |
SXT |
22/55 |
40% |
15/41 |
36.6% |
5/12 |
41.7% |
3/10 |
30% |
1/9 |
11.1% |
46/127 |
36.2% |
|
AZithromycin (30 µg) |
AZM |
18/55 |
32.3% |
13/41 |
31.7% |
4/12 |
33.3% |
3/10 |
30% |
-- |
-- |
38/127 |
29.9% |
|
Linezolid (30 µg) |
LNZ |
Oxazolidinones |
16/55 |
29.1% |
11/41 |
26.8% |
4/12 |
33.3% |
2/10 |
20% |
-- |
-- |
33/127 |
25.9% |
Doxycycline (30 µg) |
DO |
Tetracycline |
15/55 |
27.3% |
10/41 |
24.4% |
3/12 |
25% |
1/10 |
10% |
1/9 |
11.1% |
30/127 |
23.6% |
Ciprofloxacin (5 µg) |
CIP |
14/55 |
25.5% |
9/41 |
21.9% |
3/12 |
25% |
2/10 |
20% |
-- |
-- |
28/127 |
22% |
|
Fosfomycin (10 µg) |
FF |
Phosphonic acid |
14/55 |
25.5% |
9/41 |
21.9% |
2/12 |
16.7% |
1/10 |
10% |
-- |
-- |
26/127 |
20.5% |
Cefotaxime (30 µg) |
CTX |
12/55 |
21.8% |
8/41 |
19.5% |
1/12 |
8.3% |
- |
-- |
-- |
-- |
21/127 |
16.5% |
|
Gentamycin (10 ug) |
CN |
11/55 |
20% |
8/41 |
19.5% |
0 |
-- |
-- |
-- |
-- |
-- |
19/127 |
14.9% |
Genotypic profile of enterotoxigenic and β-lactam resistance genes of S. aureus isolates:
Among the selected fourteen S. aureus isolates from raw milk samples of cows, buffaloes, sheep, goat and cheese samples as demonstrated in Figure (3); nuc identification gene was identified in all isolates (100%) while, the incidence of SE (staphylococcal enterotoxins) virulence gens were analyzed in varying degrees. PCR results showed that seb gene was the most prevalent gene in 12/14 (85.7%) of all isolates followed by sed which was detected in 9/14 (64.3%) then sea was found in 28.5% (4/14) only; meanwhile sea and seg staphylococcal enterotoxins genes weren’t detected at all. For β-lactam resistance genes; PCR detected blaZ gene in all tested isolates (100%) however, mecA (methicillin or oxacillin resistant gene) was detected in 50% of S. aureus isolates. The phenotypic and genotypic profiles for the selected examined isolates from different origins were also discussed in detail in table (5).
Figure (3): Distribution of enterotoxigenic (SE) and β-lactam resistance genes of S. aureus
Table (5): phenotypic and genotypic resistance profile of some S. aureus isolates:
ID of isolate |
Strain source |
Phenotypic resistance profile |
β-lactam resistance profile |
CF1 |
Raw cow milk |
P, AMX, OX, C, N, SXT |
blaZ, mecA |
BF3 |
Raw buffalo milk |
P, N, OX, LNZ, AZM, FF, OT |
blaZ, mecA |
CF5 |
Raw cow milk |
P, C, OX, AMX, SXT, DO |
blaZ, |
BF9 |
Raw buffalo milk |
P, N, OT, SXT, DO, CIP, LNZ |
blaZ |
BS1 |
Raw buffalo milk |
P, C, N, P, SXT, LNZ, CN, OX |
blaZ. mecA |
S5 |
Raw sheep milk |
P, N, OX, AMX, CN, LNZ |
blaZ, mecA |
BS14 |
Raw buffalo milk |
P, SXT, CN, FF, C, OX |
blaZ |
CS8 |
Raw cow milk |
P, AZM, CIP, CN, LNZ |
blaZ |
S4 |
Sheep milk |
P, C, LNZ, DO, CN, AMX |
blaZ |
G3 |
Goat milk |
P, OX, OT, DO, FF, CN, SXT |
blaZ, mecA |
CS14 |
Raw cow milk |
P, N, C, OT, LNZ, AMX |
blaZ |
G4 |
Goat milk |
P, N, C, OX, AMX, LNZ, DO, FF |
blaZ, mecA |
K5 |
Karish cheese |
P, CTX, OX, OT, DO |
blaZ, mecA |
K8 |
Karish cheese |
P, C, N, OT, CIP, AZM |
blaZ |
CF: Raw bulk tank cow milk in farm, BF: Raw bulk tank buffalo milk in farm, CS: Raw cow milk from smallholder, BS: Raw buffaloe milk from smallholder, S: ewes’ sheep raw milk, G: ewes’ goat raw milk, K: Karish cheese
Discussion:
Staph aureus is an emergent pathogen of high transmission and zoonotic risk. In several reports, it had been widely isolated from raw milk and dairy products samples (Stapels et al. 2014). The contaminated milk of dairy animals with S. aureus shed frequently such pathogens that could lead to grave public human health issues especially contagious food poisoning (Oliveira et al. 2022).
It is documented that there was a proportional relation between the amount of toxin to be sufficient to cause foodborne diseases and Staphylococcus populations when it exceeds 105 CFU ml-1 (Pereira et al. 2018).
The results that were reported in table (1) in this study was lower than that recorded by (Meshref et al. 2019) who recorded that the average count of S. aureus in raw cow and buffalo milk was (1.62×108 ± 9.5×107, 7.88×107 5.19×107 CFU/ml, 8.68×107 2.61×107), respectively. In table (2), the high percentage of S. aureus counts in raw milk which was obtained by milk handler indicated the poor hygienic quality under which such milk was produced. Also, higher frequency of Staph spp. in Karish cheese could be attributed to bad preparation technique of raw milk (without any heat treatment), contaminated utensils, uneducated persons and improper storage. They could be considered that these samples were unfit for human consumption according to the parameters that were mentioned in the Egyptian Standards “ES 1008-4/2005”.
In the current study, the incidence of S. aureus was 38.5% (127/330) in all collected raw milk and Karish cheese samples (Table 3). Staph aureus isolates were confirmed as coagulase positive (CPS) in this study meanwhile, NAS strains were reported in Figure (1) of which some exhibited coagulase negative activity (CNS). This group of CNS could constitute serious threat for both animal and human health since CNS were associated with several cases of subacute and chronic mastitis in dairy animals (Makkia et al. 2022).
This data was consistent with recent studies in Portugal and Egypt by (Oliveira et al. 2022; Sadat et al. 2022) in which S. aureus was reported in 41.1% (288/700) and 40% (136/340), respectively in raw cow’s milk samples. The latter study declared that S. aureus was isolated from cow, buffalo, sheep and goat`s raw milk with 44 (36.7%), 65 (46.4%), 12 (30%) and 15 (37.5%), respectively. Identical isolation rate S. aureus (43.1%) was recorded in previous studies (Kou et al. 2021; Traversa et al. 2015). Moreover, (Saka and Terzi Gulel 2018) isolated S. aureus spp. in 30% of milk and 34% of cheese samples. Moreover, (Meshref et al. 2019) detected S. aureus in 13/25 of raw cow's milk, 16/25 of raw buffalo's milk and 34/50 of Karish cheese samples.
A little bit higher rate of S. aureus (43.1%) was stated in 62/144 milk samples (Kou et al. 2021). Moreover, high level of raw milk contamination with S. aureus spp. was recorded in many studies where it was discovered in 76.2% (Wang et al. 2022). Also, In Portugal, 53% of raw milk samples (that were collected from bulk cooling tanks) was contaminated with CPS S. aureus (Oliveira et al. 2022). In addition, all seventy-five raw milk samples were positive for Staphylococci (Alnakip et al. 2023). Also, 100% (4/4) of raw cow milk, 16/20 (80%) of goat raw milk samples and 40% of cheese samples were contaminated with S. aureus spp (Alghizzi and Shami 2021).
The discrepancies in the prevalence ratio Staphylococcus spp. in dairy animals could be attributed to the fact that mammary gland of these animals are the main reservoir for those pathogens especially in animals with clinical or subclinical mastitis. So, it could negatively affect the quality of raw milk and produce high levels of milk contamination. In addition, bad milk storage conditions accompanied by high environmental temperature in raw milk permitted the multiplication and growth of S. aureus evoking their enterotoxin (Wang et al. 2022). Furthermore, (Alnakip et al. 2023) mentioned that due to inappropriate hygienic measures particularly extensive contamination of hand personnel during cheese making or milking, inadequate thermal treatment or poor sanitation during various stages of preparation, storage, distribution and production of Karish cheese and other artisanal dairy products; varieties of food poisoning pathogens especially staphylococci spp. could be growing and might be implicated in food poisoning and gastroenteritis disorders among consumers.
Antimicrobial resistance phenomenon (AMR) in diversified sorts of bacteria is a problem of concern. AMR had been arising from an extensive use of antibiotics in food animal production, decreasing the effectiveness of different antibiotic classes for the treatment of infections in both humans and animals, particularly β-lactam antibiotics, which are the most frequently used antibiotics in the treatment of animal diseases (Pitkälä et al. 2007). The risk of the emergence of novel and more resistant bacteria could increase when these antibiotics had been used in poor nations, particularly Egypt, in subtherapeutic doses to promote growth and prevent sickness (Santy-Tomlinson 2018).
In the current study, the recovered S. aureus isolates exhibited MDR traits; (i.e., they were resistant to three or more antimicrobial agents of different antibiotic classes). A wide range of resistance (14.9% - 55.1%) were displayed against multiple antibiotics of different classes as shown in figure (2) and table (4).
MRSA Staphylococcus species had been reported as the primary cause of hospital and community-acquired infections (Gopal and Divya 2017). Globally, World Health Organization (WHO) considered MRSA as one of the three most serious difficult infectious diseases in the world (Becker and Wardenburg 2015). In the present study, MRSA was detected in all yielded S. aureus isolates from raw milk and Karish cheese in a ratio of 44.9%. Figure (2) demonstrated that MRSA was found in cows, buffoloes, sheep, goat species and Karish cheese in variant degrees. Identical results of MRSA strains that were yielded in 81/200 (40.5%) and 64/150 (42.7%) of cattle and buffalo milk samples, respectively in different localities in Egypt were recorded (Selim et al. 2022). Also, also fifty-one MRSA strains were recovered from total seventy recovered S. aureus isolates in raw milk and cheese; of which 34 were identified in raw milk samples and 17 from cheese samples (Alghizzi and Shami 2021).
Conforming results of MDR S. aureus isolates from raw cow, buffalo, sheep and goat milk samples were confirmed with (Abo-Shama 2014) against varieties of antibiotics (penicillin, ampicillin, oxacillin, amoxicilin/clavulanic acid, erythromycin and chloramphenicol). Also, high resistances against penicillin, ampicillin trimethoprim sulfamethoxazole drugs and moderate resistances to ciprofloxacin, erythromycin, clindamycin, tetracycline, chloramphenicol were recorded in MRSA strains (Sadat et al. 2022) however, they showed high sensitivity against gentamycin. In addition, (Kou et al. 2021) stated that S. aureus isolates were penicillin, oxacillin and erythromycin resistant strains in percentages of (72.6%, 37.1% and 32.3%), respectively. In the same line, (Liu et al. 2022) stated that 72.2% of S. aureus isolates were MDR strains with highest resistance rate against penicillin (50%), tetracycline (41.7%) and gentamicin drugs (36.1%). Many studies discussed MDR of S. aureus isolates from raw milk (Katreen et al. 2018; Oliveira et al. 2022). Moreover, the sensitivity of S. aureus isolates to linezolid and ciprofloxacin were in accordance with (Selim et al. 2022)
MRSA are defined as the Staph isolates that recorded resistance to oxacillin or methicillin drugs with antimicrobial sensitivity testing methods. Corresponding results of oxacillin resistance were stated by (Alghizzi and Shami 2021) in which S. aureus isolates were resistant to oxacillin (66.7%). Several studies also had focused on the prevalence of MRSA strains isolated from raw milk and relevant products (Cuiping Shi et al. 2021; Sadat et al. 2022 and Wang et al. 2022).
It is obvious that human epidemics due to staphylococcal food poisoning (SFP) might be due to the consumption of contaminated milk or dairy products with SE producing S. aureus strains (Umeda et al. 2017; Wakabayashi et al. 2018). Numerous studies had highlighted the potential hazard of SE toxins (Dinges et al. 2000; Sadat et al. 2022). PCR assay played a primary role in the detection of SE enterotoxins hence, in the current investigation, SE genes of S. aureus isolates from raw milk of different animals and from cheese samples were studied. PCR analysis as shown in figure (3) detected that seb gene was the most prevalent in all tested isolates in (85.7%) followed by sed and sea genes that were found in (64.3% and 28.5%) however, sec and see genes hadn’t been detected at all.
Corresponding results of (Alghizzi and Shami 2021) who documented that most classical SE toxins (sea, seb, sec, sed, see) were identified in raw milk samples of different animals in 29/33 (87.9%) more than from cheese samples in [4/33 (12.1%)]. Also, (Meshref et al. 2019) confirmed the presence of seb genes in 40% of all tested S. aureus strains from milk and yogurt but it was found less (20%) in both Karish cheese and ice-cream samples. Moreover, the distribution of SE enterotoxin genes of S. aureus in China was found somewhat like to current data (Chao et al. 2015). Furthermore, relevant studies determined the presence of sea and sec genes in raw milk samples with varying degrees (Cavicchioli et al. 2015; Kou et al. 2021 and Xing et al. 2016). On opposing to our data of low detection rate of sea gene, sea was the most encountered gene in MRSA isolates from raw milk followed by seb and sec genes (Sadat et al. 2022). The different prevalence rates of the SE enterotoxigenic genes might be attributed to differences in the geographical regions and sample sources (Zhao et al. 2021).
The development of β-lactam antibiotic resistance among S. aureus especially MRSA had been clarified via carrying mecA gene (Yang et al. 2016). In this study, MDR S. aureus strains showed resistance against penicillin and oxacillin (β-lactam) resistance genes using PCR tool. Also, the correlation between the phenotypic and genotypic resistance patterns of the selected isolates from different sources in this study were illustrated in table (5). The penicillin resistant (blaZ) gene was found in 100% of S. aureus isolates however, mecA (oxacillin resistant gene) was detected in 50% of S. aureus isolates. mecA gene was also found in previous studies in MRSA isolates from raw milk (80%) and from cheese (20%) samples and 60% of these positive mecA isolates were resistant to oxacillin (Alghizzi and Shami 2021; Osman et al. 2017).
Because of widely using of β-lactam drugs in treatment of bovine mastitis; they are the drugs of choice in S. aureus infections in human (Thongratsakul et al. 2020), β-lactam resistance was extremely engendered. In the same line, blaZ resistant gene was discovered in 69.2% raw milk with (Liu et al. 2022) however, it was detected in 25.8% of S. aureus isolates from milk samples in China. (Kou et al. 2021) and in 32.7% (37/113) of S. aureus isolates from raw milk (Sadat et al. 2022). This data suggested that β-lactam drugs should be limited use in treatment of animals especially food producing animals along with implementation of strict hygienic measures in dairy farms for safe public health.
Conclusions
To sum up, this inclusive data could present a great knowledge about the possibility of spreading and transmission of Staphylococcus spp which carried SE toxin genes that had a virulence potential and potential health risks. A high level of contamination with S. aureus and MRSA species (via oxacillin resistance) was also detected in examined raw milk and Karish homemade cheese in rural areas of developing countries. Consequently, proper hygiene practices at milking and during handling and milk transportation are necessitated. Also, the hygienic awareness of farm milkers and milk small holders should be raised to prevent the spread and cloning of such virulent toxigenic pathogens to humans through the food chain. The milk should be refrigerated directly after milking to prevent it from being held at unsafe temperature to avoid SE toxins of S. aureus to be released. An alarming light towards MDR S. aureus isolates and MRSA strains in raw milk and products in this study should promote a periodically monitoring programs for antibiotics use to lessen the risks for both animal and human public health and inspection visits for dairy herds should be done to assure that workers and milkers had conformed with standards.
Conflict of interest: There is no conflict of interest.